RegulonDB RegulonDB 10.9: Gene Sequence
pdxK gene sequence


Size: 852        A: 202  T: 205  G: 244  C: 201

Fasta

 

>pdxK E. coli K12. Version NC_000913.3 GI:556503834
atgagtagtttgttgttgtttaacgataagagtagggcactgcaggcggatatcgtcgcc
gtgcagtcgcaggtggtttacggcagcgtgggcaacagcattgccgtgcctgctatcaaa
cagaacggcctgaatgtctttgccgtgccgacggtattgctgagcaatacgccgcattat
gacactttctacggtggtgcgattccggacgaatggtttagcggctatttgcgtgcgctt
caggagcgtgatgcgctgcgccaacttcgtgctgtaaccacgggctatatgggaacggca
tcgcaaatcaaaatccttgccgagtggctgactgcgctacgcaaagaccatcctgaccta
ttgatcatggtcgatccggtgattggcgatattgatagcggaatttatgtcaaacctgac
cttcccgaagcgtatcgacaatatttactgccgctggcgcagggaattacccccaatatc
tttgagttggaaatcctgaccggtaaaaattgccgcgatctcgacagtgccattgctgcc
gcaaaaagtctgctttcagacacattaaaatgggtggtggttaccagcgcctccggtaat
gaagaaaatcaggagatgcaggttgtggtggtcactgccgacagcgtgaatgtcatttcc
cattcacgggtaaaaaccgacctgaaagggactggcgacctgttttgtgctcagctcatc
agtggcttgctgaaagggaaggcgttaaccgatgcagtgcaccgagcggggttgcgcgta
ctggaagtgatgcgctacacccagcagcatgagagcgatgaattgattttgccgccgctg
gcggaagcataa
              
                            

Download fasta file
RegulonDB