RegulonDB RegulonDB 10.9: Gene Sequence
yfeS gene sequence


Size: 735        A: 245  T: 202  G: 158  C: 130

Fasta

 

>yfeS E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaacgctttatttatcacgatgaaaaatcgaataaattttggtggatagattac
gaaggggatagtttagctgtcaactatggcaaggtaggtagtattggtaaattccagaca
aaagagttcgataatgaagaacagtgtctgaaagaagccagtaaattgattgccgcaaaa
atgaagaaaggctatcaagaagatccaaagtttaacttcatggatcgctactattttgat
gatgaagaaattgggttacatgttaaaacgtcacacccaaacttccagtgccattttact
gatccactttatatgtgttgctgggatgaagaatctccttttggcagcgatgaaggtgct
gatgctctaaacgttcttgaaaatagcctccgtaaagagccggatctggactgtgctgat
ttccctcaaatgttaattgaaactatgtggggtatgaaatacatcgctatggacagtatt
cttgaagaggatgttcgtgcgcaattactagtcgatgaaatgagcactatccagagcaat
atgattacctacgcaactgcattcggtcagattaaagtcatgggtaaaatctcccataaa
cttaaaaagatgggactcaatgcactagcgcgtcatcagcttaccgcaaaaattcttcaa
tggggtgacggtcaggactcaccaatacttcaaaaaatgattgatgaccttacggcgttt
cctcacgaaaattaa
              
                            

Download fasta file
RegulonDB