RegulonDB RegulonDB 10.9: Gene Sequence
murP gene sequence


Size: 1425        A: 259  T: 360  G: 419  C: 387

Fasta

 

>murP E. coli K12. Version NC_000913.3 GI:556503834
atggccaaagagatcagcagtgaacttctgaacaccattcttacccgtgtcggcggaccg
ggaaatatcgccagttgtggtaactgtatgacgcgcctgcgtctgggtgtacatgacagt
tcactggttgatcccaatatcaaaacgctggaaggcgtgaagggcgtcattttgaccagc
gaccaggtgcaggtcgtttttgggcctggtaaagcgcatcgtgccgcaaaagcgatgagc
gagctgctgggagaagcaccggtacaggatgccgcagaaatcgccgcccagaacaaacgt
cagttaaaagccaaacaaacctccggcgtgcaacaatttctcgccaaattcgccaccatc
ttcacgccgctgatccccggttttattgccgccggtctgctgctggggatagcgacgtta
attgccacggtgatgcacgttccggcagatgctcagggaacactacccgatgcgctgaat
tttatgaaggtgttcagcaaaggtttgttcactttcctggtgattctggtgggctataac
gccgcccaggcatttggcggcacgggcgtaaatggcgcaattatcgccgcgctctttttg
ctcggttataaccccgcagcgaccaccggttactacgccggttttcacgatttctttggt
ctgcccatcgatccgcgcggcaatattatcggcgtgctgattgccgcgtgggcctgcgcc
cgcattgaaggcatggtgcgccgctttatgccggacgatctcgacatgctgctgacctcg
ttaatcaccctgctgatcaccgctacgcttgcgtacctgatcattatgccgctgggtggc
tggttattcgaaggtatgtcatggctgtttatgcacctgaacagtaatccgttcggttgt
gcggttttagccgggctgttcctgatcgccgtggtatttggcgtgcatcagggctttatt
cctgtttacctcgcgttaatggacagccagggattcaacagcttatttcccatcctttca
atggcaggcgcgggccaggtgggcgcggcgctggcactctactggcgggcgcaaccgcac
agtgcgctacgcagtcaggtacgcggggcgattattcccggcctgctgggcgttggtgaa
ccgctgatttacggtgtcaccctgccccgcatgaagccgtttgttaccgcctgtttaggc
ggcgcggcgggcggtttgtttatcggcctgatagcctggtggggtctgccgatgggctta
aacagcgcctttgggccgtctggtctggtagcgctgccgctgatgacttccgcacaaggc
atccttccggccatggcggtttatgctggcgggattctggtggcatgggtttgcgggttt
attttcaccacgctctttggctgccgtaacgtcaatctggactga
              
                            

Download fasta file
RegulonDB