RegulonDB RegulonDB 10.9: Gene Sequence
yfeX gene sequence


Size: 900        A: 204  T: 192  G: 280  C: 224

Fasta

 

>yfeX E. coli K12. Version NC_000913.3 GI:556503834
atgtctcaggttcagagtggcattttgccagaacattgccgcgcggcgatttggatcgaa
gccaacgtgaaaggggaagttgacgccctgcgtgcggccagtaaaacatttgccgacaaa
ctggcaacttttgaagcgaaattcccggacgcgcatcttggtgcggtggttgcctttggt
aacaacacctggcgcgctctgagcggcggcgttggggcagaagagctgaaagattttccg
ggctacggtaaaggccttgcgccgacgacccagttcgatgtgttgatccacattctttct
ctgcgtcacgacgtaaacttctctgtcgcccaggcggcgatggaagcctttggtgactgc
attgaagtgaaagaagagatccacggcttccgttgggttgaagagcgtgacctgagcggc
tttgttgacggtacggaaaacccggcgggtgaagagacgcgtcgcgaagtggcggttatc
aaagacggcgtggatgcgggcggcagctatgtgtttgtccagcgttgggaacacaacctg
aagcagctcaaccggatgagcgttcacgatcaggagatggtgatcgggcgcaccaaagag
gccaacgaagagatcgacggcgacgaacgtccggaaacctctcacctcacccgcgttgat
ctgaaagaagatggcaaagggctgaagattgttcgccagagcctgccgtacggcactgcc
agtggcactcacggtctgtacttctgcgcctactgcgcgcgtctgcataacattgagcag
caactgctgagcatgtttggcgataccgatggtaagcgtgatgcgatgttgcgtttcacc
aaaccggtaaccggcggctattatttcgcaccgtcgctggacaagttgatggcgctgtaa
              
                            

Download fasta file
RegulonDB