RegulonDB RegulonDB 10.9: Gene Sequence
yfeZ gene sequence


Size: 450        A: 67  T: 145  G: 136  C: 102

Fasta

 

>yfeZ E. coli K12. Version NC_000913.3 GI:556503834
atgaagagtactgagtttcatcctgtccattatgatgcgcacggtcgcctgcgtttaccc
ttgctcttctggcttgtgctattgcttcaggcgcgaacctgggtgctgtttgtcattgcc
ggtgcgtcgcgcgagcagggtactgcgctgctaaatctgttttatcccgatcacgataat
ttctggctggggctgattcctggcattccggcggtgctggcgtttttgttgagcggtcgg
cgggctacgtttcctcgcacctggcgtgtactctattttctgttgctgttggcgcaggtg
gttttactttgctggcaaccgtggctgtggctgaacggtgaatccgttagcggtatcggt
ctggcgctggtagtggcggatattgtggcgttaatctggctgctgaccaatcgacgttta
cgcgcttgtttttatgaagtaaaagaataa
              
                            

Download fasta file
RegulonDB