RegulonDB RegulonDB 10.9: Gene Sequence
eutK gene sequence


Size: 501        A: 106  T: 104  G: 160  C: 131

Fasta

 

>eutK E. coli K12. Version NC_000913.3 GI:556503834
atgatcaatgcactgggattgctggaagtggacggcatggtcgccgcgatagatgcagcg
gatgccatgctcaaagcagctaacgttcgtctgctcagtcacgaagtgcttgaccctggt
cgcttaacgctggtggtggaaggcgatctggcggcgtgtcgtgcggcgctggacgcaggt
tgtgctgccgcgatgcgtaccgggcgtgtcatcagccgcaaggagatcggtcggccagac
gatgacacccagtggctggttactggctttaaccgccagccgaagcaacccgtaagggaa
cccgacgcgccagttatcgtcgcggaatctgctgacgagttgttggcgctgttaacatca
gtacgtcagggaatgacggcaggagaagtggctgcccactttggctggccgctggaaaaa
gccagaaatgcgctcgaacagctcttttctgccgggacgttacgtaaacgcagtagtcgt
tatcgtctcaagccccattaa
              
                            

Download fasta file
RegulonDB