RegulonDB RegulonDB 10.9: Gene Sequence
yffL gene sequence


Size: 642        A: 235  T: 122  G: 150  C: 135

Fasta

 

>yffL E. coli K12. Version NC_000913.3 GI:556503834
atgtttgcaacgaaagatccagagttcgaaaataggatcaacacaaataaaagcccccgg
aatgctgcaacatgccgggggcggtatgagaaacaagctaaaggagaatttctcatgtct
gatatgctagcagtagaacaagaaacaaacaatgatgttcgtcaatttttaaacaaaatt
aacgagttacggaataaagcacccaaaaacgaagagactaaacacgaagaacacacgcca
gataatcacgaggaaacagatcatcacgaggcaaaacagcaggagcaagcctggcgtggc
aacctgcgctacctggacacattaaaccgacttgatgaagtattgccccgcaaactgtac
gaaagatgggagaaagaacatacagtcaacgacgaggctgtgctacgtgctctttgttac
ttcgctggtactggcaaaaactcacagttgggatggtgcagggttggtaggggaacaatc
gacaaacgagccaggctatcaaaaaacacggttaaaaaatgcctcgatcgtctggtcaac
cacttcaaacttgttgagcgtactgaaggctatataccaggatcggcagaaagggagtgc
aacgaataccagttattattcaagccgtacaacatgaaataa
              
                            

Download fasta file
RegulonDB