RegulonDB RegulonDB 10.9: Gene Sequence
yffM gene sequence


Size: 246        A: 63  T: 63  G: 66  C: 54

Fasta

 

>yffM E. coli K12. Version NC_000913.3 GI:556503834
gtgatggttatccgccacgaatgtccgtcatattgcattgcgcagaaacgcgtggcactg
agggagttttccgaattagttttggggaccctttccctgcttctggagcaaaagacgaac
ggcaaatgcagtgcttccttgtacgactgcagcgaagaagaaaagctgtttgttaagcgc
ctgaagttaatcaaagcggatatccacgcccagctgaaggcctgtgattgcgatatttct
gaatga
              
                            

Download fasta file
RegulonDB