RegulonDB RegulonDB 10.9: Gene Sequence
yffN gene sequence


Size: 369        A: 107  T: 90  G: 98  C: 74

Fasta

 

>yffN E. coli K12. Version NC_000913.3 GI:556503834
atgaaacacgtttttaaatatcttgattttgcagaagaccgcgaacacgcagaatcagtg
gcgaccaaagagttaaaactggaccacgtagaaaaattcgctatccgcgatctagccaat
gatatcaaagagcgtgggtgtgttgagcttgtccagcctggtggattcgatgagctggtt
cagatctatgaggccggaggcgatggaatagagccactcaattgtggaatcgaatcaagg
aaggtggcaattgctgccctgcttcgcgtcatgcgtgaaccagactttcaatgcctggaa
atggttcacgaaatcataagaattgctagagatttggaagcgccagttgacgctccgtta
gattgctaa
              
                            

Download fasta file
RegulonDB