RegulonDB RegulonDB 10.9: Gene Sequence
yffO gene sequence


Size: 417        A: 137  T: 76  G: 121  C: 83

Fasta

 

>yffO E. coli K12. Version NC_000913.3 GI:556503834
atggaaggcgaactgatagaaaacaatgggttagacatttatgacaccagcgaaacaccg
aaaaagcgcggtcggccagctaaatataatgaaaaaatagcaacgcaaatcgtcctattg
gtaagcgaaggttatagtttgcgcaagatcagcatgatgccagggatgccgagccaccgt
cagatgatgcgctggcaactggagcatatggacttcagggaagggatagcctggatgtcg
tggctatggtgcgctgaagctggccgacgtgccgtcgagataatcgacgaggttgatata
aacgcagaggatgggccgaagcagttgcgcaaagcagaagcaaaggcaaaggcactactg
gcagcagccaagctgaatagtttgaaacattcaccatttggagatgacaaacaatga
              
                            

Download fasta file
RegulonDB