RegulonDB RegulonDB 10.9: Gene Sequence
yffP gene sequence


Size: 594        A: 161  T: 122  G: 157  C: 154

Fasta

 

>yffP E. coli K12. Version NC_000913.3 GI:556503834
atgagcctgatccgcactgaaaccagagacacaaaacgcgcagctgacccactgcacgac
ctgcgtagcaagccgttttctgagtggggcgaagatgaaatcaggcgttttaatctgata
gacgcgcttcttgagtttgtctacacagacacatccagcccgttcggtatcggcatgacc
ttcgattacacggagtgctgggaaattggtgttcgtgacgactgcctggtaatgacacgc
gttaagccggtgcatccagaatatgcgaagcactggaacatgaaaggcgtcatgaatgac
aaaacccgcttccacgccgacaagtgggtagggtacagcaaggtgcttgcctgggtgagc
ttatcgcacaaagacaccttcacgggtgcgaaacggtttcaatacttccaaacgatgtac
gacatggaacggcaaatcaacgcaaacctgccggttggcggccttcccaacgttgacaca
gagcgaactggcaaactgttccaacgcgatgacttttctgaggatagccatgccaacgat
ccgaagttggttggtgatgattacgtcccccaggcaccggagcaaatcaactga
              
                            

Download fasta file
RegulonDB