RegulonDB RegulonDB 10.8: Gene Sequence
yffQ gene sequence


Size: 378        A: 110  T: 105  G: 109  C: 54

Fasta

 

>yffQ E. coli K12. Version NC_000913.3 GI:556503834
atgaaacttttaatcgcaatcatcctgatggtgctgactggtgtttgctttgcagatgtt
ggtgattacaggctgaacggggaggataacgcaagaattgaatcagtcgttactgataac
tgtgaaaaaacagccgtattggtaggcggtgacaggcttgcgagggttgagatcgaatat
atagcgacattgtgcaagccggtggctttggtgattatttacgacagatttgacgatata
gcggcaatccctcttaaggtgacgttgaaaaaggtattgaaagagaatagcgatgaaaag
attaacctattgaacaagatgggggatctggctggtcgtatcgttgcagagcagtattta
ggcatgagttttgagtaa
              
                            

Download fasta file
RegulonDB