RegulonDB RegulonDB 10.8: Gene Sequence
yffS gene sequence


Size: 810        A: 259  T: 142  G: 249  C: 160

Fasta

 

>yffS E. coli K12. Version NC_000913.3 GI:556503834
atgagttacgaaatcaaaatttgcgacatcctcaaaggcgctgcgatggaaggacaatat
aagggcgctcaacgtggggccaaatgcgaggagatcgcaaacgagttaactcgccgggga
gttaaaaacaacaagggagaggttattactaagggcggcgttagccattggctggaaggt
agacgggagccaaatttcgacactctggctgaactgtgcgacatgttcggcgtttatgcc
ctgatgccgatgcgtggcggtaaatggattcgagttcacccggaagaccgtggagaaatg
gaattacgcgaggctgtagctgaacgagatgctattatcgacgacctgaaggcccgtatc
gctgagcttgaggcggcactagcaaataaacaagtcccagcagaagcggaagagatggga
ggtgaaaaagtggaagaagtggcagcagagcaagcgcccaacgatgaaaaagagatggga
gctaaggagtgggttaacccgaacccgaaaaaatacagcgtcggcatgttgtgtcaggta
ctggctgcaatgggcggcgaatacctgggcaacaacgcagggttacagcagaagatcact
gtgttggataacgacggcaaccggaagccaatcagtaacggcgcgttttatcgactgatt
gagcaggccaaagggagaggattgattagcgttgaacaggaaatcaaacacaagaaagac
gaaaacggcaaccagatcggcaaaggcaagaaaggtgacaagctgataactttgcttccc
aactggattgataagctgggagacgaataa
              
                            

Download fasta file
RegulonDB