RegulonDB RegulonDB 10.9: Gene Sequence
eutA gene sequence


Size: 1404        A: 263  T: 311  G: 423  C: 407

Fasta

 

>eutA E. coli K12. Version NC_000913.3 GI:556503834
gtgaacactcgccagctattgagcgtcggtatcgatatcggcaccaccaccacccaggtg
attttctcccggctggagctggttaaccgtgcggcggtgtcgcaggtgccgcgctacgaa
ttcattaaacgcgaaattagctggcaaagtccggtgttctttacccctgtcgataaacag
ggcggtttaaaagaagcggaactgaaaaccttaatactcgagcaatatcatgctgcgggt
attgagccggaaagcgttgattctggtgccatcatcatcaccggtgaaagcgcgaaaacc
cgcaatgctcgcccggcggtgatggcgctctctcagtcgctgggcgattttgtcgttgcc
agcgccgggccgcacctcgaatccgtgatcgccggtcacggagccggggcacaaaccctt
tctgaacaacggctgtgtcgggtactgaatatcgacatcggcggtggcaccgcgaactac
gccctgttcgatgccggaaaaatcagcggcactgcctgcctcaacgtcggtggtcgcctg
ctggaaaccgacagccacgggcgcgtggtttacgctcataaaccggggcagatgattgtg
gatgagtgcttcggtgcaggcaccgacgcccgttcgctgaccggcgcgcagctggtgcag
gtgacccggcggatggcagaactgattgtcgaagtgattgacggaacgctctcaccgctc
gcgcaggcattgatgcaaaccggtttgctgcccgcaggtgttacgcccgaaatcattacg
ctttctggcggcgtgggcgaatgttatcgccaccagcccgccgacccgttctgttttgcc
gatattggcccgctgctggcaactgcgctgcatgaccatccgcgcctgcgtgagatgaac
gtacagtttccggcgcaaaccgtgcgcgccacggtgattggcgcgggcgcgcataccctt
tcgctctctggcagcacaatctggcttgagggcgtacaactgccgctgcgcaatttgccg
gtggcgatcccgattgatgaaacggatctggtgggggcctggcaacaggcgctgattcag
ctggatcttgatcccaaaactgacgcgtacgtgctggcgcttcccgcctcgctgcctgtg
cgttacgccgcggtactgacggtcatcaacgcgttggtcgatttcgtcgcgcgttttccg
aatccgcatcccctgctggtggtggccgggcaggactttggtaaagctctgggcatgttg
ttgcgcccacagctacaacaactcccgttggcagtcattgacgaagtgattgtccgcgcg
ggggactatatcgacattggtacgcctctttttggcggatcggttgtgccggtgacggtg
aaatcactcgcatttccttcctga
              
                            

Download fasta file
RegulonDB