RegulonDB RegulonDB 10.9: Gene Sequence
eutH gene sequence


Size: 1227        A: 239  T: 311  G: 361  C: 316

Fasta

 

>eutH E. coli K12. Version NC_000913.3 GI:556503834
atgggaattaacgaaatcatcatgtacatcatgatgttctttatgctgatagctgccgta
gacaggatcctgtcgcagttcggcggttctgctcgtttcctcggtaagttcggtaaaagt
atcgaaggatcaggcggtcagttcgaagaaggctttatggcaatgggcgcactgggcctg
gcgatggtcggtatgaccgcgctggcaccggtactggctcacgttctcgggccggtaatt
attccggtttacgaaatgctcggcgctaacccatcgatgttcgccggaacactgctggcg
tgcgatatgggcggcttcttcctcgccaaagagctggcgggcggcgacgtagccgcgtgg
ctatactctgggttaattctcgggtcgatgatggggccaacgattgtgttttccattccg
gtggcgctcggcattatcgaaccttctgaccgtcgttatctggcgctcggcgtgctggcg
ggcattgtgaccattccgattggttgtatcgctggtggtctggttgctatgtactccggt
gtgcagatcaacggccagccggtggaattcactttcgccctgatcctgatgaacatgatc
ccggtgatcattgttgcgattctggtggcgctggggctgaaattcatcccggaaaaaatg
atcaacggcttccagatcttcgccaaattcctcgttgcattgatcaccctcggtcttgcc
gctgcggtagtgaaattcctgcttggctgggaactgatccccggtctggatcctatcttt
atggcccctggcgataaacccggtgaggtgatgcgcgccattgaagttatcggttctatc
tcctgcgttctgttaggggcgtatccgatggtgctgctgctgactcgctggtttgaaaaa
ccgctgatgagcgtcggtaaagtactgaatatgaacaacatcgcggcagccggcatggtg
gcaacgcttgccaacaacatcccgatgttcggcatgatgaagcagatggatacccgcggc
aaagtcatcaactgcgccttcgccgtttccgctgctttcgccctgggcgaccacttaggc
ttcgccgctgccaacatgaacgccatgatcttcccgatgattgtcggcaagttgatcggc
ggcgtaacggcgattggcgtggcgatgatgctggtgccaaaagaagacgcgaccgcgact
aaaaccgaagcggaggcacaatcgtga
              
                            

Download fasta file
RegulonDB