RegulonDB RegulonDB 10.9: Gene Sequence
eutG gene sequence


Size: 1188        A: 238  T: 254  G: 385  C: 311

Fasta

 

>eutG E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaatgaattgcagaccgcgctctttcaggcgttcgataccctgaatctgcaacgg
gtaaaaacatttagcgttccaccggtgacgctttgcggtccgggctcggtgagcagttgc
ggacagcaagcgcaaacgcgtgggctgaaacatctgttcgtgatggcagacagctttttg
catcaggcagggatgaccgccgggctgacgcgtagcctgaccgttaaaggtatcgccatg
acgctctggccatgtccggtgggcgaaccgtgcattaccgacgtgtgtgcagccgtggcg
cagttgcgtgagtcaggctgtgatggggtgatcgcgtttggcggcggctcggtgctggat
gcggcgaaagccgtgacgttgctggtgacgaacccggatagcacgctggcagagatgtca
gaaaccagcgttctgcaaccgcgcttgccgctgattgccattccaactaccgccggaacc
ggctctgaaaccaccaatgtaacggtgattatcgacgcggtgagcgggcgcaagcaggtg
ttagcccatgcctcgctgatgccggatgtggcgatcctcgacgccgcattgaccgaaggt
gtgccgtcgcatgtcacggcgatgaccggcattgatgcgttaacccatgccattgaagca
tacagcgccctgaacgctacaccgtttaccgacagtctggcgattggtgccattgcgatg
attggcaaatcgctgccgaaagcggtgggctacggtcacgaccttgccgcgcgcgagagc
atgttgctggcttcatgtatggcgggaatggcgttttccagtgcgggtcttgggttgtgc
cacgcgatggcgcatcagccgggcgcggcgctgcatattccgcacggtctcgcgaacgcc
atgttgctgccaacggtgatggaatttaaccggatggtttgtcgtgaacgctttagtcag
attggtcgggcactgcgaactaaaaaatccgacgatcgtgacgctattaacgcggtaagt
gagctgattgcggaagttgggattggtaaacgactgggcgatgttggtgcgacatctgcg
cattacggcgcatgggcgcaggccgcgctggaagatatttgtctgcgcagtaacccgcgt
accgccagcctggagcagattgtcggcctgtacgcagcggcgcaataa
              
                            

Download fasta file
RegulonDB