RegulonDB RegulonDB 10.9: Gene Sequence
eutJ gene sequence


Size: 837        A: 171  T: 175  G: 269  C: 222

Fasta

 

>eutJ E. coli K12. Version NC_000913.3 GI:556503834
atggcgcacgacgaacaatggctcaccccacgtctgcaaacggcggcaacgctgtgtaac
cagacgcccgccgcgacggaatctccgctgtggctgggggtggatctgggcacctgcgat
gtggtgtcgatggttgtcgaccgcgacggtcagccagtggcggtatgcctcgactgggcc
gatgtggttcgcgacggcatcgtctgggatttcttcggcgctgtcaccattgttcgtcgc
catctcgacacgctcgagcagcaattcggtcgtcgttttagccatgcggcgacttcattt
cctccaggtacggacccgcgtatttccatcaacgtgctggaatctgccggactggaagtg
agccatgtgctggatgagccaaccgcagttgcggatctgctgcaactggacaacgccggt
gtagtggatatcggcggcggcactaccggcattgccatcgtgaaaaagggcaaggtgacg
tactcggcggatgaagccaccggcggacatcacatctctctgactctcgccggaaatcgc
cgtatttcgctggaagaggcggagcagtacaagcgcggtcacggtgaagagatttggcct
gcggtgaaaccggtgtacgaaaaaatggcggacattgtcgcccggcatattgaagggcag
ggcattactgatttatggctggcgggcggctcttgtatgcaaccgggcgtggcggaactg
tttcgcaaacaattcccggcgttacaggtgcatttaccgcagcacagtttgtttatgacc
ccgctggcgatcgccagtagtgggcgagagaaagcggaggggctatatgcaaaatga
              
                            

Download fasta file
RegulonDB