RegulonDB RegulonDB 10.9: Gene Sequence
eutE gene sequence


Size: 1404        A: 331  T: 271  G: 421  C: 381

Fasta

 

>eutE E. coli K12. Version NC_000913.3 GI:556503834
atgaatcaacaggatattgaacaggtggtgaaagcggtactgctgaaaatgcaaagcagt
gacacgccgtccgccgccgttcatgagatgggcgttttcgcgtccctggatgacgccgtt
gcggcagccaaagtcgcccagcaagggttaaaaagcgtggcaatgcgccagttagccatt
gctgccattcgtgaagcaggcgaaaaacacgccagagatttagcggaacttgccgtcagt
gaaaccggcatggggcgcgttgaagataaatttgcaaaaaacgtcgctcaggcgcgcggc
acaccaggcgttgagtgcctctctccgcaagtgctgactggcgacaacggcctgacccta
attgaaaacgcaccctggggcgtggtggcttcggtgacgccttccactaacccggcggca
accgtaattaacaacgccatcagcctgattgccgcgggcaacagcgtcatttttgccccg
catccggcggcgaaaaaagtctcccagcgggcgattacgctgctcaaccaggcgattgtt
gccgcaggtgggccggaaaacttactggttactgtggcaaatccggatatcgaaaccgcg
caacgcttgttcaagtttccgggtatcggcctgctggtggtaaccggcggcgaagcggta
gtagaagcggcgcgtaaacacaccaataaacgtctgattgccgcaggcgctggcaacccg
ccggtagtggtggatgaaaccgccgacctcgcccgtgccgctcagtccatcgtcaaaggc
gcttctttcgataacaacatcatttgtgccgacgaaaaggtactgattgttgttgatagc
gtagccgatgaactgatgcgtctgatggaaggccagcacgcggtgaaactgaccgcagaa
caggcgcagcagctgcaaccggtgttgctgaaaaatatcgacgagcgcggaaaaggcacc
gtcagccgtgactgggttggtcgcgacgcaggcaaaatcgcggcggcaatcggccttaaa
gttccgcaagaaacgcgcctgctgtttgtggaaaccaccgcagaacatccgtttgccgtg
actgaactgatgatgccggtgttgcccgtcgtgcgcgtcgccaacgtggcggatgccatt
gcgctagcggtgaaactggaaggcggttgccaccacacggcggcaatgcactcgcgcaac
atcgaaaacatgaaccagatggcgaatgctattgataccagcattttcgttaagaacgga
ccgtgcattgccgggctggggctgggcggggaaggctggaccaccatgaccatcaccacg
ccaaccggtgaaggggtaaccagcgcgcgtacgtttgtccgtctgcgtcgctgtgtatta
gtcgatgcgtttcgcattgtttaa
              
                            

Download fasta file
RegulonDB