RegulonDB RegulonDB 10.9: Gene Sequence
eutM gene sequence


Size: 294        A: 61  T: 62  G: 98  C: 73

Fasta

 

>eutM E. coli K12. Version NC_000913.3 GI:556503834
atggaagcattaggaatgatcgaaacccggggcctggttgcactgattgaggcttctgac
gcgatggtgaaagctgcgcgcgtcaagctggttggtgttaagcagattggcggcggcctg
tgtactgccatggttcgtggtgatgttgcagcctgtaaagccgcgaccgatgcaggtgcc
gcagcggcacagcgtatcggcgagctggtatctgtacacgttatcccgcgtccgcacggc
gacctggaagaagtcttcccgatcggcctgaaaggcgatagcagcaacctgtaa
              
                            

Download fasta file
RegulonDB