RegulonDB RegulonDB 10.8: Gene Sequence
eutD gene sequence


Size: 1017        A: 210  T: 215  G: 310  C: 282

Fasta

 

>eutD E. coli K12. Version NC_000913.3 GI:556503834
atgattattgaacgttgtcgtgaactggcgttgcgagcgcccgccagagtggtttttccg
gatgcgttagaccaacgtgtgctgaaagccgcgcaatatttacatcaacaaggtctggca
acgcccattctggtcgccaatccgtttgaacttcgtcagtttgcgctcagtcacggcgtg
gcgatggacgggctacaggtgattgatccgcatggcaacctcgcaatgcgggaagaattt
gctcatcgctggctggcccgcgcgggcgaaaaaacgccgccggatgcgctggaaaaactt
accgaccctctgatgttcgccgcagcaatggtcagcgccggtaaagcggatgtctgtatc
gcgggcaacctctcttccacggcaaatgtgctgcgtgccggattacgcattatcggcttg
cagccaggctgtaaaacgctctcttccattttcctgatgttgccacagtacagcggcccg
gcgttgggctttgccgattgcagcgtggtgccacagccgacggcggcgcagctggcggat
atcgcgcttgccagtgccgaaacctggcgcgccatcaccggagaagagccgcgcgtggcg
atgctgtcgttttccagcaatggtagcgcccgtcacccctgtgttgctaacgtccagcag
gcgacagaaatcgtccgtgagcgcgcaccaaagctggtggtggatggcgagttacagttt
gacgccgccttcgtgccggaagtggcggcgcaaaaagcgcctgccagcccgctacagggc
aaggccaatgtgatggtttttccgtcgctggaagccggaaatattggttacaaaatcgca
caacgactcggcggatatcgtgccgtcgggccactgatacaaggacttgccgcgccgatg
cacgatctctctcgtggttgtagcgtgcaggaaattatcgagctggcgctggtggcagct
gtgccgcgtcagacagaagtgaaccgcgaaagcagtttacaaacactggttgaatga
              
                            

Download fasta file
RegulonDB