RegulonDB RegulonDB 10.8: Gene Sequence
eutT gene sequence


Size: 804        A: 177  T: 156  G: 241  C: 230

Fasta

 

>eutT E. coli K12. Version NC_000913.3 GI:556503834
atgaaagatttcatcaccgaagcatggctaagagcgaaccatacgctcagcgaaggcgca
gagatccatctccctgcggacagtcgcctgacgccctctgcccgggagttgctggaaagc
cgccatctgcgcatcaagtttattgacgagcagggccgcctgtttgttgacgatgaacag
cagcagccgcagcccgttcatgggctgaccagtagcgatgaacatccgcaggcgtgctgc
gaactgtgtcgccagccggtggcaaaaaagccggatacgctgactcacctgtcggcggaa
aaaatggtcgccaaaagcgatccgcgtctgggttttcgcgcggttctcgacagcaccatt
gcgctggcagtgtggctgcaaattgaactggcggaaccgtggcagccgtggctggcggat
atccgttcgcgtcttggcaacattatgcgcgccgatgcgctgggggaaccgctgggctgc
caggcgattgtcgggctttctgacgaagatctgcatcggctttctcatcagccgctgcgc
tatctcgaccacgatcatctggtgccggaagccagccacgggcgcgatgctgcgttgctc
aatctgctacgcaccaaagtgcgggaaaccgaaaccgtagcggcgcaggtctttatcacc
cgcagctttgaagtattacgcccggacattttgcaggcgctgaaccgcctttcgagcacg
gtctacgtgatgatgatcctgagcgtaacgaagcagccgctaacggtgaagcagatccaa
caacgactgggggaaacgcaatga
              
                            

Download fasta file
RegulonDB