RegulonDB RegulonDB 10.9: Gene Sequence
eutS gene sequence


Size: 336        A: 86  T: 80  G: 95  C: 75

Fasta

 

>eutS E. coli K12. Version NC_000913.3 GI:556503834
atggataaagaacgcatcattcaggaatttgtgcccggcaaacaggtcacactggcgcat
ctcatcgcgcatcccggtgaggaactggcgaagaaaatcggcgttccggatgcgggcgca
attggcattatgacgctaactcccggcgaaacggcgatgatcgccggtgatttagcgctg
aaagccgctgatgtgcatatcggttttctcgaccgattcagcggtgcattggtgatttat
ggctcggtgggcgcagtagaagaagcgttatcacaaaccgtcagcggtttaggtcgctta
ttaaattatacgctttgtgaaatgaccaaaagttaa
              
                            

Download fasta file
RegulonDB