RegulonDB RegulonDB 10.9: Gene Sequence
maeB gene sequence


Size: 2280        A: 535  T: 511  G: 663  C: 571

Fasta

 

>maeB E. coli K12. Version NC_000913.3 GI:556503834
atggatgaccagttaaaacaaagtgcacttgatttccatgaatttccagttccagggaaa
atccaggtttctccaaccaagcctctggcaacacagcgcgatctggcgctggcctactca
ccaggcgttgccgcaccttgtcttgaaatcgaaaaagacccgttaaaagcctacaaatat
accgcccgaggtaacctggtggcggtgatctctaacggtacggcggtgctggggttaggc
aacattggcgcgctggcaggcaaaccggtgatggaaggcaagggcgttctgtttaagaaa
ttcgccgggattgatgtatttgacattgaagttgacgaactcgacccggacaaatttatt
gaagttgtcgccgcgctcgaaccaaccttcggcggcatcaacctcgaagacattaaagcg
ccagaatgtttctatattgaacagaaactgcgcgagcggatgaatattccggtattccac
gacgatcagcacggcacggcaattatcagcactgccgccatcctcaacggcttgcgcgtg
gtggagaaaaacatctccgacgtgcggatggtggtttccggcgcgggtgccgcagcaatc
gcctgtatgaacctgctggtagcgctgggtctgcaaaaacataacatcgtggtttgcgat
tcaaaaggcgttatctatcagggccgtgagccaaacatggcggaaaccaaagccgcatat
gcggtggtggatgacggcaaacgtaccctcgatgatgtgattgaaggcgcggatattttc
ctgggctgttccggcccgaaagtgctgacccaggaaatggtgaagaaaatggctcgtgcg
ccaatgatcctggcgctggcgaacccggaaccggaaattctgccgccgctggcgaaagaa
gtgcgtccggatgccatcatttgcaccggtcgttctgactatccgaaccaggtgaacaac
gtcctgtgcttcccgttcatcttccgtggcgcgctggacgttggcgcaaccgccatcaac
gaagagatgaaactggcggcggtacgtgcgattgcagaactcgcccatgcggaacagagc
gaagtggtggcttcagcgtatggcgatcaggatctgagctttggtccggaatacatcatt
ccaaaaccgtttgatccgcgcttgatcgttaagatcgctcctgcggtcgctaaagccgcg
atggagtcgggcgtggcgactcgtccgattgctgatttcgacgtctacatcgacaagctg
actgagttcgtttacaaaaccaacctgtttatgaagccgattttctcccaggctcgcaaa
gcgccgaagcgcgttgttctgccggaaggggaagaggcgcgcgttctgcatgccactcag
gaactggtaacgctgggactggcgaaaccgatccttatcggtcgtccgaacgtgatcgaa
atgcgcattcagaaactgggcttgcagatcaaagcgggcgttgattttgagatcgtcaat
aacgaatccgatccgcgctttaaagagtactggaccgaatacttccagatcatgaagcgt
cgcggcgtcactcaggaacaggcgcagcgggcgctgatcagtaacccgacagtgatcggc
gcgatcatggttcagcgtggggaagccgatgcaatgatttgcggtacggtgggtgattat
catgaacattttagcgtggtgaaaaatgtctttggttatcgcgatggcgttcacaccgca
ggtgccatgaacgcgctgctgctgccgagtggtaacacctttattgccgatacatatgtt
aatgatgaaccggatgcagaagagctggcggagatcaccttgatggcggcagaaactgtc
cgtcgttttggtattgagccgcgcgttgctttgttgtcgcactccaactttggttcttct
gactgcccgtcgtcgagcaaaatgcgtcaggcgctggaactggtcagggaacgtgcacca
gaactgatgattgatggtgaaatgcacggcgatgcagcgctggtggaagcgattcgcaac
gaccgtatgccggacagctctttgaaaggttccgccaatattctggtgatgccgaacatg
gaagctgcccgcattagttacaacttactgcgtgtttccagctcggaaggtgtgactgtc
ggcccggtgctgatgggtgtggcgaaaccggttcacgtgttaacgccgatcgcatcggtg
cgtcgtatcgtcaacatggtggcgctggccgtggtagaagcgcaaacccaaccgctgtaa
              
                            

Download fasta file
RegulonDB