RegulonDB RegulonDB 10.9: Gene Sequence
ypfG gene sequence


Size: 1044        A: 229  T: 245  G: 317  C: 253

Fasta

 

>ypfG E. coli K12. Version NC_000913.3 GI:556503834
atgcgctatcgcattttccttctcttttttttcgctttgttgccgacgtctttggtgtgg
gcggcaccagcgcaacgggcgttttccgactggcaggtcacctgtaataaccaaaatttc
tgcgtggcgcgtaatacgggcgatcataatggactggtgatgaccctgagccgcagcgcc
ggggcgcataccgatgccgttttacgtattgagcgcggcggattgaagtcgccggaggcg
tcagaaggggagatagcgccacggctgctgttagatggcgagccgttggcgttaagtggt
gacaagtggcggatttcaccatggttattagtaaccgatgatacggcaaccatcaccgcg
tttttgcagatgattcaggaagggaaggcaatcaccttacgcgatggcgatcagaccatt
tctctgagtggcttaaaagcagcgttgttgtttattgatgctcagcaaaagcgcgttggc
agtgaaaccgcgtggatcaagaaaggggacgaaccgccgctcagcgtaccgcccgcgcct
gcgctgaaagaggtcgcggtggttaacccaacgccgacgccactctcactcgaagaacgc
aacgatttgctggattatggaaactggcggatgaatggtctgcgctgctcgcttgatcca
ttgcgtcgtgaggtgaatgtcactgcgctgactgatgataaagcgctgatgatgattagc
tgtgaggcaggggcctataacaccattgatttggcatggattgtgtcgcgtaaaaagcca
ctagcttcgcgcccggttcggttgcgtttgccgttcaacaacggtcaggagacgaatgaa
ctggaactgatgaacgcaacatttgatgagaaatcgcgtgaactggtgaccttagcgaaa
gggcgcggattaagcgattgtggcattcaggcgcgctggcgctttgacggtcagcgtttt
cgcctggtgcgttacgccgcagaacccacctgcgataactggcatgggccagacgcctgg
cccacgttgtggatcacccgttaa
              
                            

Download fasta file
RegulonDB