RegulonDB RegulonDB 10.9: Gene Sequence
ypfH gene sequence


Size: 699        A: 154  T: 168  G: 220  C: 157

Fasta

 

>ypfH E. coli K12. Version NC_000913.3 GI:556503834
atgaaacatgaccattttgttgttcaaagcccggataaacctgcgcaacagttgttactg
cttttccacggtgtcggggataacccggtggcaatgggggaaataggcaactggtttgca
ccgctgtttcctgatgcgctggtggtgagtgtcggtggcgcggagccgagcggtaatccg
gcggggcgtcagtggttttcggtgcagggtattacggaagataatcgccaggcgcgtgtg
gatgcgatcatgccgacgtttattgaaacggtgcgctactggcagaaacagagcggagta
ggggctaacgccacggcgctcatcggtttctctcaaggcgcgattatggtgctggagagc
attaaagccgaaccgggccttgcttcacgcgtcattgcttttaacggacgctatgcgagc
ctgccggaaactgcgtctacagccacgacaattcacctgattcatggcggtgaagatccg
gttatcgatctggcgcatgcggttgcggcgcaggaagcgttaatcagtgccggtggtgac
gtgacgctggatatcgtggaggatttaggccatgcgatcgacaatcgcagtatgcaattt
gccctggatcacttgcgttataccattccgaaacattatttcgacgaagcgctaagtggc
ggtaagcctggcgatgatgatgtgattgaaatgatgtaa
              
                            

Download fasta file
RegulonDB