RegulonDB RegulonDB 10.9: Gene Sequence
tmcA gene sequence


Size: 2016        A: 420  T: 482  G: 593  C: 521

Fasta

 

>tmcA E. coli K12. Version NC_000913.3 GI:556503834
atggctgaactgactgcgcttcacacattaacagcgcaaatgaaacgtgaagggatccgc
cgcttgctggtgttgagcggggaagagggttggtgttttgagcatactcttaagttgcgt
gatgccttacctggcgactggctgtggatttcgccgcggccagatgctgaaaaccactgt
tctccctcggcactacaaactttacttgggcgcgagttccggcatgcggtattcgacgcc
cgccacggctttgatgccgctgcctttgccgcacttagcggaacgttgaaagcgggaagc
tggctggttttgttactccctgtatgggaagagtgggaaaaccaacctgatgccgactcg
ctgcgctggagtgattgccctgaccctattgcgacgccgcattttgtccagcatctcaaa
cgcgtacttacggcggataacgaggctatcctctggcggcaaaaccagccattctcgttg
gcgcattttactccccgtactgactggtaccccgcgactggcgcaccacaaccagaacaa
cagcaactcttaaagcagctaatgaccatgccgccgggcgtggcagcggtaacggctgcg
cgtgggcgcggtaagtcggcgttggcagggcaactcatttctcgtattgcgggcagagcg
attgtcaccgcgcccgcaaaagcgtcaacggatgtactggcacaatttgcgggcgagaag
tttcgctttattgcgccggatgccttgttagccagcgatgagcaagccgactggctggtg
gtcgatgaagccgcagccatacctgcgccattgttgcatcaactggtatcgcgttttcct
cgaacgttgttaaccactacggtgcagggctacgaaggcaccggacgtggttttttgctg
aaattttgcgctcgctttccgcatttacaccgttttgaactgcaacagccgatccgctgg
gcgcagggatgcccgctggaaaaaatggtcagcgaggcactggtttttgacgatgaaaac
ttcacccatacaccacaaggcaatattgtcatttccgcatttgaacagacgttatggcaa
agcgatccagaaacgccgttaaaggtttatcagctcttgtctggtgcgcactatcggact
tcgccgctggatttacgccggatgatggatgcaccagggcaacattttttacaggcggct
ggcgaaaacgagattgccggggcgctgtggctggtggatgagggtggattatctcaacaa
ctcagtcaggcggtatgggcaggttttcgtcgcccgcggggtaatctggtggcccagtcg
ctggcggcgcacggcaacaatccactggcggcgacattgcgtggacggcgggtcagccgg
atagcagttcatccggctcgtcagcgggaaggcacagggcggcaacttattgctggtgct
ttgcaatatacgcaagacctcgactatctttcggtgagttttggttacaccggggagtta
tggcgtttctggcaacgctgcggttttgtgctggtgcggatgggtaatcatcgggaagcc
agcagcggttgctatacggcgatggcgctgttaccgatgagtgatgcgggtaaacagctg
gctgaacgtgagcattaccgtttacgtcgcgatgcgcaagctctcgcgcagtggaatggc
gaaacgcttcctgttgatccactaaacgatgccgtcctttctgacgacgactggcttgaa
ctggccggttttgctttcgctcatcgtccgctattaacgtcgttaggttgcttattgcgt
ctgttacaaaccagtgaactggcattaccggcgctgcgtgggcgtttacagaaaaacgcc
agtgatgcgcagttatgtaccacacttaaactttcaggccgcaagatgttactggtccgt
cagcgggaagaggccgcgcaggcgctgttcgcacttaatgatgttcgcactgagcgtctg
cgcgatcgcataacgcaatggcaattatttcactga
              
                            

Download fasta file
RegulonDB