RegulonDB RegulonDB 10.9: Gene Sequence
ypfJ gene sequence


Size: 864        A: 215  T: 186  G: 256  C: 207

Fasta

 

>ypfJ E. coli K12. Version NC_000913.3 GI:556503834
atgcgttggcaagggcgacgtgaaagtgacaatgttgaagacaggcgcaacagctctggt
ggtccatctatgggcggtcccggttttcgcctgccaagcggtaaaggcgggctgatttta
ctgatagtcgtgctggttgcaggctactatggtgttgatttaaccgggttgatgaccggg
cagccggtttcccaacaacaatcaacgcggtcaattagcccaaatgaagacgaagccgca
aaattcacctcggtgattctggcaaccacggaagacacctggggacaacagttcgagaag
atgggtaagacctatcagcaaccgaagctggtcatgtaccgtggaatgacgcgtaccggc
tgcggggcgggccagtccataatggggccgttctattgcccggcggatggcacggtttat
atcgatctctccttctatgatgacatgaaagacaaacttggcgcggatggcgattttgcc
caggggtacgttatcgcccatgaagtcggtcatcatgtgcagaaactgttaggcatcgag
ccgaaagttcgtcaactgcaacaaaacgcgacgcaggcggaagtaaaccgcttatctgtg
cgtatggaactccaggccgactgttttgccggtgtctgggggcatagtatgcagcagcaa
ggcgttctggaaaccggcgatctggaagaggcgctgaacgcggcgcaggccatcggcgat
gaccgtttacaacagcaaagtcaggggcgagtagtaccagacagtttcactcatggcact
tctcagcaacgctacagctggtttaaacgtggtttcgacagcggcgatccggcacaatgc
aatacttttggtaaaagcatttaa
              
                            

Download fasta file
RegulonDB