RegulonDB RegulonDB 10.9: Gene Sequence
hyfE gene sequence


Size: 651        A: 132  T: 172  G: 175  C: 172

Fasta

 

>hyfE E. coli K12. Version NC_000913.3 GI:556503834
atgaccggttctatgatcgtaaataatctggcgggactgatgatgctgacatcgctgttt
gtgattagcgtcaaaagctatcgcctgtcatgcggattttacgcctgccagtcactggtg
ctggtgtctattttcgccactctctcgtgcctgttcgccgcagagcaactgctgatctgg
tccgccagcgcctttatcaccaaagtgctgctggtaccgttaatcatgacttacgctgca
cgaaatattccccagaacatcccggaaaaagcgttattcggtccggcaatgatggcactg
ctcgcggcgttaattgtcctgctttgcgcatttgtcgttcagcccgtgaagctaccgatg
gctaccgggctgaaaccggcgctggcggtagcgttaggtcattttctgcttggcctgctg
tgcattgtcagccagcgcaatatcctgcggcaaatttttggttactgcctgatggaaaac
ggctcccatctggtgctggcgcttcttgcctggcgagcaccggaactggtggaaataggt
atcgctaccgacgccatcttcgccgtcattgtgatggtgttactggcaagaaaaatatgg
cgtacccacggcacgctggacgtgaacaacttgaccgcgctgaagggataa
              
                            

Download fasta file
RegulonDB