RegulonDB RegulonDB 10.9: Gene Sequence
hyfG gene sequence


Size: 1668        A: 359  T: 403  G: 466  C: 440

Fasta

 

>hyfG E. coli K12. Version NC_000913.3 GI:556503834
gtgaacgttaattcatcgtcaaatcgtggcgaagcgattctcgccgccctgaaaacgcag
ttccccggcgcggtgctggatgaagagcgacaaacgcctgaacaggtcaccattacggtg
aaaatcaatctgctgcctgacgttgtacagtatctttattatcaacatgatggctggctt
ccggtcctgtttggcaacgacgagcggacacttaacggtcattacgcggtttattatgcc
ctttcaatggaaggggccgaaaaatgctggattgtggtgaaggcgctggtcgatgccgac
agtcgggagtttccgtcagtcacaccgcgcgtccctgccgcggtctggggcgagcgagaa
attcgcgatatgtacgggctgattccggttggcctgccggatcagcgtcgcctggtgttg
cccgatgactggccggaagatatgcatccgctgcgcaaagatgcgatggattatcgactg
cgccctgaaccgacgactgattccgaaacgtatccgtttatcaatgagggcaacagcgat
gcgcgggtgatccctgtcggcccgctgcatatcacctccgatgaaccgggtcacttccgc
ttgtttgtggatggcgagcaaattgtcgatgctgattaccgcctgttttatgtccatcgc
ggcatggagaaactggcagaaacgcggatgggctacaacgaagtgaccttcttatcggac
cgcgtgtgtgggatttgcggttttgcccacagtgtggcctataccaattcggttgaaaat
gcactggggattgaggtgccgcaacgagcacatactattcgctcgattctgctggaagtc
gaacggctacacagtcatttgcttaaccttggcctctcctgccatttcgttggttttgat
accggctttatgcaatttttccgcgtgcgggaaaagtcgatgacgatggcggaattgctg
atcgggtcgcgtaaaacctacggtctgaatctgattggtggtgttcgccgcgatattctc
aaagagcaacgtctgcaaacgctgaaactggtgcgcgagatgcgcgccgacgtgtcggag
ctggtagagatgctgcttgctacgccgaatatggaacaacgcactcagggcattggcatt
ctcgaccgacaaatcgcccgtgatttgcgctttgatcacccctacgccgactacggcaat
attccaaaaacactgtttacctttaccggcggcgatgttttctcccgcgtgatggtccgt
gtcaaagagacgtttgattcgctggcaatgctggaatttgccctcgacaacatgccggat
accccactgctgaccgaaggctttagctataaacctcacgcattcgcgctgggctttgtt
gaagcgccacgcggtgaagacgtgcactggagcatgctcggtgataaccaaaaattgttc
cgctggcgctgccgtgccgccacctacgccaactggccggtgttgcgttacatgctgcgc
ggcaataccgtttctgacgcaccgctgattatcggtagccttgatccctgctactcctgt
accgaccgtgtgacgctggtagatgtgcgcaagcgccagtcaaaaaccgtgccgtataaa
gagatcgaacgctacggcattgatcgtaaccgttcgccgctgaagtaa
              
                            

Download fasta file
RegulonDB