RegulonDB RegulonDB 10.9: Gene Sequence
hyfH gene sequence


Size: 546        A: 137  T: 109  G: 140  C: 160

Fasta

 

>hyfH E. coli K12. Version NC_000913.3 GI:556503834
atgctgaagttactgaaaactattatgcgcgccggaaccgcgacggtgaaatatcccttc
gcgccactggaggtcagccctggctttcgcggaaaaccggacctgatgcccagccaatgt
attgcctgcggtgcctgcgcctgtgcttgtccggcaaatgcgctgactatccagaccgac
gaccagcaaaattcgcgcacctggcagctctatctggggcgttgtatttactgcggacgt
tgtgaagaagtgtgcccgaccagagccatccagcttaccaataactttgaactgaccgtc
accaataaagccgatctctatacccgcgcgacgttccatctacaacgttgcagccgttgc
gaacgcccgtttgccccgcaaaaaaccatcgcactggctgctgaattgttagcacagcaa
caaaatgcgccacaaaaccgcgaaatgttgtgggcgcaagcgagcgtctgcccggaatgc
aaacaacgcgcgacgctgatcaacgacgatacagatgtactgctggtggctaaggagcag
ctatga
              
                            

Download fasta file
RegulonDB