RegulonDB RegulonDB 10.9: Gene Sequence
hyfI gene sequence


Size: 759        A: 153  T: 183  G: 207  C: 216

Fasta

 

>hyfI E. coli K12. Version NC_000913.3 GI:556503834
atgagtccagtgcttacacaacatgtcagccagcccatcacgctggacgagcaaacgcaa
aagatgaagcggcatttgctacaggatatccgtcgctcggcttacgtttatcgcgtcgat
tgcggcggctgcaacgcctgtgaaatcgaaatttttgctgccattacaccagtattcgac
gcagaacgttttggcattaaggttgtttcatcaccgcgtcacgccgatattttgttattt
actggcgcagtcacccgggcgatgcgtatgcctgcacttcgggcgtatgagtctgccccc
gatcataaaatttgtgtttcctacggcgcgtgcggtgtcggcggcggtattttccacgat
ctctacagcgtctggggcggtagcgacaccattgtccccattgatgtttggatccccggc
tgcccgccaacaccggccgccaccattcacggtttcgccgtggcgctcggtttgctgcaa
cagaagattcacgctgtggattatcgcgatcccaccggggtgactatgcaaccgttgtgg
ccgcagatcccgccatcacagcgtatcgccattgagcgagaagcgcggcggctggcgggc
tatcgtcaggggcgagaaatttgcgatcggctcctgcgccatttaagcgacgatcctaca
ggaaatcgggttaacacctggttgcgcgatgccgacgatccacgtctcaatagtatcgtt
cagcaactctttcgcgtactccgggggttacatgactga
              
                            

Download fasta file
RegulonDB