RegulonDB RegulonDB 10.9: Gene Sequence
yfgO gene sequence


Size: 1062        A: 177  T: 310  G: 322  C: 253

Fasta

 

>yfgO E. coli K12. Version NC_000913.3 GI:556503834
atgctcgaaatgttgatgcaatggtatcgccgccgttttagcgacccggaagcgattgcc
ttgctggttattttagttgccggatttggcattatctttttctttagtggcctgcttgct
ccgttgctggtggctattgtgctggcctatttgctggaatggccaaccgtgcgtctgcaa
tctattggctgctcccgccgctgggcgacgtcgattgtattggtggttttcgtcggtata
ttgctactgatggcgttcgtggtactgcctatcgcctggcaacagggcatctacttaatc
cgcgatatgccggggatgctcaataagctttctgactttgccgccacgttgccgcgccgc
tatccggcgttaatggacgcgggcattattgatgcaatggccgaaaatatgcgcagtcgg
atgctgaccatgggcgattcggtggtgaaaatttccctcgcctcgctggtcggtttgctg
accatagccgtctatctggtgctggtgccattgatggtcttcttcctgctgaaagacaaa
gagcagatgctgaacgccgttcgccgggtgctgccgcgtaaccgtgggctggcaggacag
gtgtggaaggagatgaatcaacaaatcaccaactatatccgcggcaaagtgctggagatg
atcgtggtggggatcgccacctggctggggttcttgctcttcgggctgaactattcgctg
ctgctggcagtgctggtcggcttctcggttcttattccgtacattggcgcatttgtggtg
accattccggtggttggcgtggcgctattccagtttggcgcaggtactgaattctggagc
tgcttcgcggtgtatctgattattcaggcgctggacggcaacctgttagtgccggtgttg
ttctccgaagcggttaacctgcatccgctggtgattattttatcggtggtgatcttcggt
ggtttgtggggattctggggcgtattcttcgccattccgttggcgacgctgatcaaagcc
gtgattcatgcctggcccgatgggcaaatcgcgcaagaataa
              
                            

Download fasta file
RegulonDB