RegulonDB RegulonDB 10.9: Gene Sequence
bepA gene sequence


Size: 1464        A: 358  T: 317  G: 402  C: 387

Fasta

 

>bepA E. coli K12. Version NC_000913.3 GI:556503834
atgttcaggcagttgaaaaaaaacctggttgcaaccctcattgctgctatgaccattggt
caggtagccccggcgtttgccgacagcgcagacaccttgccggatatgggaacctccgca
ggaagcacgctttccattggtcaggaaatgcagatgggcgactattatgtccgccagcta
cgcggcagcgcgccgttaattaatgacccgctgttaacgcaatatattaattcgctgggg
atgcgtctggtttcgcatgccaattcggttaagacaccgtttcatttttttctgatcaac
aacgacgaaattaacgcctttgctttctttggcggcaacgtggtgctgcactctgccctg
ttccgttattccgataacgaaagtcaactggcttcagttatggcgcacgaaatctcccac
gtcacccaacgtcacctggcgcgagcgatggaagatcagcagcgcagcgcgccgctgacc
tgggtcggcgcgttaggttctattttactggcgatggccagtccgcaggcggggatggcg
gcgctgaccggtacactggcgggaacgcgtcaggggatgatcagtttcacccagcaaaat
gaacaggaagcggaccgcattggtattcaggtgctgcaacgctcgggattcgatccgcag
gcgatgccaaccttcctcgaaaaattactcgatcaggcgcgttactcctcgcgcccgccg
gaaattttattgactcacccgttgccggaaagtcgtctggcagatgcccgcaaccgtgct
aatcagatgcgcccgatggtggtgcagtcgtcggaagatttctatctggcgaaagcgcgc
acactggggatgtataattccggacgtaaccagctcaccagtgatttgctggatgaatgg
gcgaaaggaaacgttcgtcagcaacgagcagcacaatatggtcgtgctttacaggcgatg
gaagccaataaatacgacgaggcgcgtaaaacgctgcaaccgttactggcggcagaacct
ggcaacgcatggtatctcgatctggctactgatatcgatcttgggcaaaacaaagccaat
gaggcgatcaatcgtctgaaaaatgcccgcgatttacgcaccaatccggtgttgcagctc
aacctggcgaacgcttatttgcaaggcggtcaaccacaagaagcggccaatattctgaat
cgctacacctttaataataaagatgacagcaacggctgggatttgctggcacaggcggaa
gccgcgctaaataaccgcgatcaggagctggctgcgcgagcagaaggttatgcgctcgcc
ggacgactcgatcaggccatttcgctgttgagtagcgccagttcgcaggtgaaattaggc
agcctgcaacaagcgcgttacgatgcgcgcatcgaccagttgcgccagctgcaggaacgc
tttaagccttataccaagatgtaa
              
                            

Download fasta file
RegulonDB