RegulonDB RegulonDB 11.1: Gene Sequence
yfgD gene sequence


Size: 360        A: 103  T: 68  G: 108  C: 81

Fasta

 

>yfgD E. coli K12. Version NC_000913.3 GI:556503834
atgaccaaacaggtaaaaatctaccataacccacgctgttcaaagagccgggaaacgctg
aacctgctgaaagaaaacggcgtggagccagaagtggtgctctaccttgagacacccgcc
gatgcggcaacgctgcgcgatttgctgaaaatactggggatgaatagcgcccgtgaattg
atgcgccagaaagaggatctttataaagaactgaacctggctgacagttcgcttagcgaa
gaggcgctgattcaggcaatggtggataatccgaagctgatggagcgcccgattgtggtc
gcgaatggcaaagcgcggattggtcgtccaccggagcaggtactggaaatcgtgggttaa
              
                            

Download fasta file
RegulonDB