RegulonDB RegulonDB 10.9: Gene Sequence
hda gene sequence


Size: 702        A: 146  T: 178  G: 209  C: 169

Fasta

 

>hda E. coli K12. Version NC_000913.3 GI:556503834
ctgaacacaccggcacagctctctttgccactttatcttcctgacgacgaaacctttgca
agtttctggccgggggataactcctctttactggccgcgctgcaaaacgtgctgcgtcag
gaacatagcggttacatctatctctgggcacgcgaaggcgcggggcgcagccatctgctg
cacgcggcttgcgcggaattgtcgcagcgtggcgatgcggtgggctatgtcccgctggat
aaacgcacctggtttgttccggaagtgctcgacggtatggagcatttgtcgctggtctgt
atcgacaacattgagtgtattgcaggcgatgagttgtgggagatggcgattttcgatctc
tacaatcgaattctggaatcgggcaaaacacggttgttgatcaccggcgatcgtccaccg
cggcagttgaatctgggattaccggatctcgcgtcgcgactcgactgggggcagatctac
aaattgcagccactttctgatgaagataagttgcaggcgctacagttacgcgcgcgtttg
cgtggttttgaactgccggaagatgtggggcgtttcttgctgaagcggctcgacagagaa
atgcgcacgctatttatgacgttggatcagttggatcgtgcgtcgattaccgcgcaacgt
aagctgaccattccgtttgtgaaagaaattctgaagttgtag
              
                            

Download fasta file
RegulonDB