RegulonDB RegulonDB 10.9: Gene Sequence
yfgG gene sequence


Size: 192        A: 50  T: 47  G: 39  C: 56

Fasta

 

>yfgG E. coli K12. Version NC_000913.3 GI:556503834
gtgagtcaggcaaccagtatgcgaaaacgacaccgatttaacagtcgcatgacccgtatc
gtactgctcatcagctttatcttcttctttggccgttttatctactcgtccgtcggtgcc
tggcagcaccatcagagcaaaaaagaagctcagcaatccacactctccgtcgaatcaccg
gtacaacgttag
              
                            

Download fasta file
RegulonDB