RegulonDB RegulonDB 10.9: Gene Sequence
yfgH gene sequence


Size: 519        A: 150  T: 124  G: 127  C: 118

Fasta

 

>yfgH E. coli K12. Version NC_000913.3 GI:556503834
gtgatgaaatttaaaaaatgtcttctgcctgtggcaatgttagcgtcattcactctggca
ggatgccagtcaaatgctgacgatcatgctgccgatgtttatcaaaccgatcaactgaat
accaaacaagaaactaaaaccgttaatattatttccattcttcccgcaaaagttgccgta
gacaactcccaaaataaacggaacgcacaagccttcggcgcgcttattggcgcagtcgct
ggcggtgttatcggccacaacgtcgggtctggcagcaattccggaacgacggcaggtgca
gttggcggcggagctgtaggcgcggcagcgggttctatggtgaatgataaaaccttagtg
gaaggtgtttctttaacctataaggaaggcaccaaagtgtatacctctacccaggtgggt
aaagagtgccagtttacgacaggtttagccgttgttattaccacgacgtataacgaaacg
cgtattcagccaaataccaaatgtcctgaaaagagctaa
              
                            

Download fasta file
RegulonDB