RegulonDB RegulonDB 10.9: Gene Sequence
yfgJ gene sequence


Size: 216        A: 54  T: 59  G: 57  C: 46

Fasta

 

>yfgJ E. coli K12. Version NC_000913.3 GI:556503834
atggaactgcattgtccacaatgtcagcatgtgcttgatcaggataacggccatgcgcgt
tgccgatcctgcggggaatttattgaaatgaaagctctttgtccagactgccatcaaccg
ttgcaggtgttaaaagcctgtggtgcagtagattacttctgtcagcacgggcatggcttg
atatcgaaaaaacgcgttgaattcgtgctggcttaa
              
                            

Download fasta file
RegulonDB