RegulonDB RegulonDB 10.10: Gene Sequence
pbpC gene sequence


Size: 2313        A: 470  T: 531  G: 694  C: 618

Fasta

 

>pbpC E. coli K12. Version NC_000913.3 GI:556503834
atgcctcgcttgttaaccaaacgcggctgctggataacgttggcagccgcgccctttctc
ctttttcttgcagcgtggggagcagataaactctggcctctaccgctgcatgaagtcaat
cccgcacgagtggtcgtggcgcaggatggtacgccgctctggcgcttcgccgatgctgac
ggcatctggcgttatccggtaacaatcgaagatgtttctccacgttaccttgaagcgctg
atcaattatgaagatcgctggttctggaagcatccgggggtgaatccattctcggtggcg
cgcgcagcatggcaagatctcacttcgggacgggttatttccggtggcagcacgctcact
atgcaggttgctcgtctgcttgatcctcaccccaaaacatttggcggcaaaattcgccag
ctctggcgcgcgttgcaactggaatggcatctgtctaagcgtgaaattctgaccttgtat
cttaaccgcgctccgtttggcggtacgttgcaggggatcggtgcggcaagttgggcttat
ctcggaaaatcgcctgcgaatttaagctattccgaggcggcaatgctggcggttttgccg
caagcgcccagccgtcttcgcccggatcgttggccggagcgtgccgaagccgcgcgtaat
aaagtgctcgaacggatggccgtgcaaggtgtgtggtcccgtgagcaggtaaaagagtca
agggaagaacccatctggctggccccccgacaaatgccgcaactggcaccgctgttttcg
cgcatgatgctcggtaaaagcaaaagcgacaaaatcactactacgttggatgccggtctt
caacgacgtctggaagaactggcgcaaaactggaaagggcggttgccaccgcgcagctca
ctggcgatgatcgtggttgatcataccgatatgcgtgttcgcggctgggtgggatcggtt
gatctcaacgatgattcacgctttggtcatgttgatatggtcaattcgatccgatcgcca
ggatcagtgctcaaaccgtttgtttatggtctggcgctggatgaaggcttgatccacccg
gcatcactgctgcaagacgtcccccggcgcaccggtgattatcgaccaggtaactttgat
agcggttttcatggcccgatcagcatgagcgaggcgctggtgcgctcgctgaacttacct
gctgtgcaggtgctggaagcctatggaccgaaacggtttgcggcaaagttacgcaatgtt
ggattgccgttatatttgcccaacggtgctgcgccgaatctttcactcattctcggcggc
gctggtgcaaaactggaagatatggcggcagcgtataccgcgtttgctcgccacggcaag
gcaggcaaattgcgcttacagcctgacgatccgctgcttgaacggcctttaatgtcgtcg
ggggcggcgtggatcattcgccggattatggctgatgaagcgcaacccttgccggatagt
gccttgccgcgcgtcgccccactggcatggaaaacgggcaccagctatggctatcgtgac
gcctgggcgattggggttaacgctcgctatgtcattgggatctggactggcagaccggac
ggcacgcccgttgttggtcagtttggctttgccagtgccgtaccattgttgaatcaggtc
aataatatcttactgtcgcgcagtgcgaatctgccggaagacccgcgcccgaactcagtc
actcgtggcgttatctgctggccgggcggacagtctttgccggaaggtgacggtaactgt
cgccgccgcctggcaacctggctgctggacgggagtcagccgccaactctattactgccg
gagcaggaaggcattaatggcattcgtttccccatctggctggatgaaaatggcaaacgt
gttgccgctgattgcccgcaagcgcgacaagaaatgataaatgtctggccgctaccgctg
gaaccctggctgcccgcatcagaacgtcgcgctgtgcgcttaccaccggcctcgacaagt
tgcccgccatacggtcacgatgcccagctcccgctgcagctgacaggcgttcgcgatggc
gcgattattaaacgtttaccgggcgcagcggaagcgactttgccgttgcaatcaagtgga
ggggcaggtgaacgctggtggtttctgaatggcgaaccgttaactgaacgcgggcgcaac
gtgaccctgcatttgacggataaaggtgattatcaattgctggtgatggatgacgtgggg
caaatcgcgacagtgaaatttgtcatgcaatag
              
                            

Download fasta file
RegulonDB