RegulonDB RegulonDB 10.9: Gene Sequence
yfhM gene sequence


Size: 4962        A: 1210  T: 1124  G: 1423  C: 1205

Fasta

 

>yfhM E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagttacgcgtagccgcctgcatgctaatgctggcgctggcagggtgcgacaac
aacgataacgcgccaacagcggtgaaaaaagatgcgccttctgaagttactaaagcggcc
tcttcagaaaacgcgagttcagcaaaactctccgtgccggagagacaaaaactggcccaa
cagagtgccggtaaggtgctgacattgctggatctctctgaagtccaacttgatggtgca
gccacgctggtgctgacgttctccatccctctcgacccggatcaggatttctcacgcgtt
attcatgtcgtcgataaaaaaagcggcaaagtggatggtgcctgggagctgtcagataat
cttaaagagttacgtttacgccacctcgaaccgaaacgtgatttgatcgttactattggc
aaggaggtcaaagcactcaacaacgcaaccttcagtaaagattacgaaaaaactataact
acccgcgacatccaacccagcgtcggttttgccagccgtggttcgctgctgcctggcaaa
gtcgttgaagggctgccggtaatggcgctcaacgttaataatgtcgatgttaacttcttc
cgcgttaagccagaatctctgccagcattcattagccaatgggaataccgcaattcgctg
gcgaactggcagtcagacaaactgctgcagatggcggatctggtctacaccggacggttt
gatctcaatcctgcgcgtaacacccgtgaaaaattattgctgccgctgggcgatatcaaa
ccgcttcagcaggcgggcgtgtatctggctgtgatgaatcaggctggacgttacgattac
agtaatcccgcgacgctgtttacgttaagtgatatcggcgtttcagctcaccgttatcac
aatcgtctggatatctttacccaaagtctggaaaacggcgcggcccagcaaggaattgaa
gtctctttattaaatgagaaagggcagactctgactcaggcaaccagtgacgctcagggg
catgtgcagctggaaaatgataaaaacgcggcattactgttggcgcgtaaagacggtcag
acaacgctactcgatttaaaacttccggcgctggacttagcagaatttaacattgctggc
gcgccaggctatagcaaacagtttttcatgtttggcccacgcgatctttatcgcccaggt
gaaacggtaatcctcaatggtttgctgcgtgatgcagacggtaaagcgttgcccaatcaa
cccatcaagttagacgtgattaaacccgatgggcaggtactcaggagcgtcgttagtcag
ccggagaatggcctctaccactttacctggccactcgatagcaatgcggcaaccggtatg
tggcatattcgcgctaacacgggcgataatcagtatcggatgtgggatttccacgtcgaa
gattttatgccagagcgcatggcgctgaatctgaccggtgagaaaaccccgctaacgccg
aaagatgaagtgaaattctccgtggtggggtactacctgtatggtgcacctgctaatggt
aatactttgcaagggcaacttttcctgcgcccactgcgtgaagctgtgtcagccttacct
ggttttgaattcggcgatatagctgccgaaaatctttcccgcacgctggatgaagttcag
ttgacgctggatgataaagggcgcggcgaagtttctacagaaagccagtggaaggaaacg
cattccccattacaggttattttccagggtagtttgctggaatcgggcggtcgcccggtg
acgcgccgcgctgagcaggctatctggcctgccgatgcattgccggggatccgtccgcag
ttcgcctcgaaatcggtttacgattatcgtactgacagcacggtgaaacagcccattgtt
gatgaaggcagtaacgccgcttttgacatcgtttatagcgatgcgcaaggcgtgaaaaaa
gccgtgtcgggcttgcaggtgcgcctgattcgcgaacgccgcgattactactggaactgg
tcagaagatgaaggctggcagtcacagtttgatcaaaaagatctgatcgaaaatgaacaa
actctggatctgaaagcggacgaaaccggcaaggtcagttttccggtagagtggggcgct
tatcgtctggaagtcaaagcgccgaatgaagcggtcagtagtgttcgtttctgggctggc
tatagctggcaggacaacagcgacggtagcggcgcagtgcgacccgaccgtgtcacgctg
aaactggataaagccagttatcgccctggcgacaccattaagttgcatatcgccgcgcca
acggcgggtaaaggttatgcgatggtcgagtccagtgaagggccgctgtggtggcaagag
attgatgttcgggctcaagggctggatctgacgattccggtcgataaaacctggaatcgt
catgatctgtatttaagtacgctggtggtacgtcctggcgataaatctcgctccgcgacg
ccaaaacgcgcggttggtgtgttgcatctgccgcttggcgatgaaaaccgtcgcctcgat
ctggcgctggaaacaccagcaaaaatgcgtcccaatcaaccattaaccgtgaaaattaaa
gccagcactaaaaatggcgagaagcctaaacaggtgaatgtgctggtgtctgccgttgat
agtggtgtgctgaatattactgactacgtcacgccagatccgtggcaggcgttctttggt
cagaaacgctatggcgcagacatttacgatatttacggtcaggttattgaaggtcagggg
cgtctggcagctctgcgtttcggtggcgatggtgatgagctgaaacgtggtggtaaaccg
ccggtcaatcacgtcaatattgtcgtgcagcaggcgctgccggtaacgctcaacgaacag
ggcgaaggctcggttacactgccgattggcgattttaacggtgaattgcgcgtcatggcg
caagcctggacggcagatgacttcggtagcaacgaaagtaaagtgatagttgccgcaccg
gtgattgctgaactgaacatgccgcgctttatggcgagtggcgatacctcgcgtctgacg
ctggatatcactaatcttaccgataaaccgcaaaaactgaacgttgccctgaccgccagt
ggtttgcttgaactggtcagcgattcacccgcagccgttgaattagcgccaggtgtgcgt
actacgctgtttatcccggtgcgagcattgccgggttatggcgatggagaaattcaggcc
accattagcgggttagcgttaccgggtgaaaccgttgccgatcagcataagcagtggaaa
atcggcgtccgtccggcgttcccggcacaaacggttaattacggtacggcgttacagcct
ggtgagacatgggcgattccggcggatggattgcaaaacttctcgcctgttacgctggaa
gggcaattgttgttgagcggcaaaccaccgctgaacatcgcacgttatatcaaagagtta
aaagcgtatccgtacggctgtcttgagcaaaccgccagcggcctgtttccgtcactttat
accaacgcagcccaactgcaggcgttgggcatcaaaggcgacagtgatgagaaacgccgt
gcatcggtcgatatcggcatttcccgtttgctgcaaatgcaacgtgataacggcggcttt
gcgctgtgggataaaaacggtgacgaagagtactggctgacggcttacgtgatggatttc
ctggtccgcgcaggcgaacagggttacagcgtgccgacagacgccattaaccggggtaat
gagcgtctgctgcgctatttacaagatccgggcatgatgtcgatcccgtacgcggataat
ctcaaagccagtaaattcgccgtacagtcttacgctgcgctggtgttggcccgtcagcaa
aaggctccgctgggtgcgctgcgtgaaatctgggagcatcgtgcagatgccgcttctggt
ttaccgctgctgcaacttggcgttgcgctgaaaaccatgggtgatgcgacgcgtggtgaa
gaagcgattgcgctggcgctgaaaacgccgcgtaatagtgatgagcggatatggctgggt
gattacggtagttcactgcgcgacaacgcgttaatgctctccttgctggaagaaaataaa
ctgctacccgatgagcagtacactttgctgaacacactttcgcagcaggcgtttggtgaa
cgctggctatcgacgcaggaaagtaacgcgttgttcctggctgcccgtacgattcaggat
ttacccggtaaatggcaggcgcaaacctctttctcagctgagcagctgacaggcgagaaa
gcgcaaaacagcaatctgaatagcgatcaacttgtcaccttgcaggtgagcaacagtggc
gatcagccgttatggttgcgtatggatgccagcggttatccgcaatccgcacctttaccg
gcgaacaatgtgctgcaaatcgagcgtcatattcttggtactgatggtaagagcaaatcg
ctggactcgttacgtagcggcgatctggtgctggtgtggttgcaggtaaaagccagtaac
agcgtgccggatgcgttagtcgtggatctgctgcctgcgggtctggaactggaaaaccag
aatctggcgaacggtagcgccagcctggagcaaagtggtggcgaagtgcagaacttactg
aaccagatgcagcaggcgagcattaagcacattgagttccgtgacgatcgctttgtggcg
gcggttgccgttgatgaataccaaccggtaacgctggtgtatctggcgcgggcggtgacg
ccgggaacgtatcaggtaccgcaaccgatggtggaatcaatgtatgttccccaatggcgg
gcgaccggcgcggctgaagatctgctgattgtcagaccgtaa
              
                            

Download fasta file
RegulonDB