RegulonDB RegulonDB 10.8: Gene Sequence
iscU gene sequence


Size: 387        A: 114  T: 79  G: 105  C: 89

Fasta

 

>iscU E. coli K12. Version NC_000913.3 GI:556503834
atggcttacagcgaaaaagttatcgaccattacgagaatccgcgtaacgtgggttccttt
gacaacaacgacgagaacgtcggcagcggcatggtgggggcaccggcctgtggcgacgtg
atgaagttgcagattaaagtcaacgatgaaggtatcattgaagacgcgcgttttaaaact
tacggctgcggttccgctatcgcttccagctccctggtcaccgaatgggtgaaagggaag
tctctcgacgaagcgcaggcgatcaaaaacaccgatattgctgaagaacttgaactgccg
ccggtgaaaattcactgttctattctggcagaagacgcgatcaaagccgccattgcggac
tataaaagcaaacgtgaagcaaaataa
              
                            

Download fasta file
RegulonDB