RegulonDB RegulonDB 10.8: Gene Sequence
iscS gene sequence


Size: 1215        A: 298  T: 269  G: 326  C: 322

Fasta

 

>iscS E. coli K12. Version NC_000913.3 GI:556503834
atgaaattaccgatttatctcgactactccgcaaccacgccggtggacccgcgtgttgcc
gagaaaatgatgcagtttatgacgatggacggaacctttggtaacccggcctcccgttct
caccgtttcggctggcaggctgaagaagcggtagatatcgcccgtaatcagattgccgat
ctggtcggcgctgatccgcgtgaaatcgtctttacctctggtgcaaccgaatctgacaac
ctggcgatcaaaggtgcagccaacttttatcagaaaaaaggcaagcacatcatcaccagc
aaaaccgaacacaaagcggtactggatacctgccgtcagctggagcgcgaaggttttgaa
gtcacctacctggcaccgcagcgtaacggcattatcgacctgaaagaacttgaagcagcg
atgcgtgacgacaccatcctcgtgtccatcatgcacgtaaataacgaaatcggcgtggtg
caggatatcgcggctatcggcgaaatgtgccgtgctcgtggcattatctatcacgttgat
gcaacccagagcgtgggtaaactgcctatcgacctgagccagttgaaagttgacctgatg
tctttctccggtcacaaaatctatggcccgaaaggtatcggtgcgctgtatgtacgtcgt
aaaccgcgcgtacgcatcgaagcgcaaatgcacggcggcggtcacgagcgcggtatgcgt
tccggcactctgcctgttcaccagatcgtcggaatgggcgaggcctatcgcatcgcaaaa
gaagagatggcgaccgagatggaacgtctgcgcggcctgcgtaaccgtctgtggaacggc
atcaaagatatcgaagaagtttacctgaacggtgacctggaacacggtgcgccgaacatt
ctcaacgtcagcttcaactacgttgaaggtgagtcgctgattatggcgctgaaagacctc
gcagtttcttcaggttccgcctgtacgtcagcaagcctcgaaccgtcctacgtgctgcgc
gcgctggggctgaacgacgagctggcacatagctctatccgtttctctttaggtcgtttt
actactgaagaagagatcgactacaccatcgagttagttcgtaaatccatcggtcgtctg
cgtgacctttctccgctgtgggaaatgtacaagcagggcgtggatctgaacagcatcgaa
tgggctcatcattaa
              
                            

Download fasta file
RegulonDB