RegulonDB RegulonDB 11.0: Gene Sequence
trmJ gene sequence


Size: 741        A: 170  T: 160  G: 225  C: 186

Fasta

 

>trmJ E. coli K12. Version NC_000913.3 GI:556503834
atgctgcaaaatattcgaattgtgctggtggagacgtcacacaccggcaatatgggttct
gttgcccgtgccatgaaaacaatgggattaaccaatctgtggctggttaatccactggtg
aaacccgactcccaggcgattgccctggcagcaggggccagcgatgtgattggtaatgct
cacatcgtcgatacgctcgacgaagcgttagccggttgtagcctggtggtgggcaccagc
gcacgttcccgcacgctgccatggccgatgctcgacccgcgcgaatgcggcctgaaaagc
gtcgctgaagcggcaaataccccggtggcgctggtgtttggtcgcgagcgcgtcggcttg
accaatgaagagttgcagaaatgccattatcatgtcgcgattgcggctaacccggaatac
agctcgctgaacctggcgatggcggttcaggttattgcctatgaagtgcgcatggcctgg
ctggcaactcaggaaaacggcgagcaggtcgagcatgaagagacgccgtatccgctggtc
gatgatctggagcgtttttatggtcatctggaacaaacgctgctggcaaccggttttatc
cgtgaaaaccatccggggcaggtgatgaataaattgcgccgtctgtttacccgtgcgcgc
ccggaaagccaggagttgaatatcctgcgcgggattctggcttctattgagcagcagaat
aaaggtaacaaggccgaataa
              
                            

Download fasta file
RegulonDB