RegulonDB RegulonDB 10.9: Gene Sequence
hcaT gene sequence


Size: 1140        A: 167  T: 329  G: 351  C: 293

Fasta

 

>hcaT E. coli K12. Version NC_000913.3 GI:556503834
atggttttgcaatccacgcgctggttggcgctcggctatttcacatacttttttagttac
ggcatttttctacctttctggagcgtctggcttaaagggattggtttaacgccagaaacc
atcggcctgttattgggggcaggtctggttgcccgtttcctcgggagtttgctcatcgcg
ccccgcgtcagcgatccttcccgcctgatttccgccttgcgcgtgctggcactgctgaca
cttctctttgctgtcgccttctgggcgggggcgcacgtagcgtggctgatgctggtgatg
attggctttaacctctttttctcaccactggtaccgttgaccgatgcactggcgaatacg
tggcaaaagcagttcccgcttgattacggcaaagtgcgactgtggggctcggtggcgttt
gtcattggctcggcgctgacgggcaaactggtcactatgtttgattatcgggtgatcctc
gcgctgttgacgttgggcgtggcatccatgctgctcggctttctcatccgtccgacgatt
cagccacaaggggcaagtcgccagcaggagagcaccggttggtctgcgtggttggcgctg
gttcgccagaactggcgctttctggcctgcgtttgtttattgcagggggcacatgcggcc
tattacggttttagcgccatttactggcaggcagctggctactcggcctcggcggtgggg
tatttgtggtcgctgggcgtggtggcggaagtcattatctttgcgctgagtaataaactt
ttccgccgttgtagtgcacgcgatatgctgttgatctcggcgatttgcggcgtagtgcgc
tggggcattatgggagcaactacggcgttgccgtggttgatagtggtgcaaattctgcat
tgcggcaccttcacggtctgccacctggccgccatgcgttatattgctgctcgccagggt
agcgaagtcatccgtttacaggcggtttactctgccgtcgcgatgggcggcagtatcgct
atcatgaccgttttcgccggtttcctgtatcaatatctgggccacggcgtgttctgggta
atggcgctggtggcgcttccggcaatgtttttgcgcccgaaagttgttccctcatgctga
              
                            

Download fasta file
RegulonDB