RegulonDB RegulonDB 10.9: Gene Sequence
rseB gene sequence


Size: 957        A: 228  T: 243  G: 237  C: 249

Fasta

 

>rseB E. coli K12. Version NC_000913.3 GI:556503834
atgaagcaactttggtttgccatgtcattagtgacaggtagcctgttattctctgctaac
gcctcggccactcccgcgtccggggcgttattacagcagatgaacctggccagtcagtca
ctgaattacgagctgtcattcatcagcatcaataaacagggtgttgagtctctgcgttat
cgacatgcacgcctcgataaccgtcctcttgcacaattgttgcaaatggatggcccgcgc
cgggaagtggtacagcgcggcaatgaaatcagctattttgaaccgggacttgaaccgttc
acgcttaatggcgattacattgttgattctctgccatcgcttatctataccgatttcaaa
cgcctttctccttactacgactttatctccgtcgggcgcacgcgtattgctgatcgtctt
tgcgaagtcattcgcgtggttgcccgagatggtacacgctacagctacatcgtgtggatg
gacaccgaatcgaaattaccgatgcgggttgatctccttgatcgcgatggtgaaacgctg
gaacaatttcgcgtgattgcttttaacgtcaatcaggatatcagcagcagtatgcagacg
ctggcgaaggcaaatttgccgccgttgctttctgttcctgtaggtgaaaaagctaaattc
agctggacgccaacctggttgccacagggttttagcgaagtttccagtagtcgacgtccg
ctaccgacgatggacaacatgcctatcgaatcacgtctctattccgacggattattcagc
ttctcggtaaacgttaaccgcgctacgccatcgagcaccgatcagatgttgcgcaccgga
cgcagaaccgtcagtacaagcgtacgtgataacgccgaaatcaccattgtcggtgaactg
ccgccgcaaacggcgaaacgcattgccgagaatattaagttcggggcagcgcaatga
              
                            

Download fasta file
RegulonDB