RegulonDB RegulonDB 10.9: Gene Sequence
tapT gene sequence


Size: 699        A: 156  T: 177  G: 175  C: 191

Fasta

 

>yfiP E. coli K12. Version NC_000913.3 GI:556503834
atgaccgaaaacgctgttctccagttacgcgccgagcgtattgcgcgcgcaacacgtcct
tttcttgcccgcggtaatcgcgttcgtcgctgccaacgctgtcttttgccagagaaatta
tgtctctgttcgacaattaccccagcacaagcaaaaagtcgcttctgtttgctgatgttc
gacaccgagccaatgaagcccagtaataccgggcgtctcattgctgatattttgcctgat
accgttgcgtttcaatggtcgcgtaccgaaccctcgcaggatttgctggagttggtgcaa
aacccggactatcagccaatggtggtctttcccgcttcgtatgctgatgagcaacgggaa
gtgatcttcacaccacctgccggtaagccaccgctgtttatcatgctcgatggtacctgg
ccggaagctcgcaagatgtttcgtaaaagtccgtatctggataatcttcccgtcatttcc
gtcgatctttcccggctttctgcctatcgcctgcgtgaagcccaggctgaaggccaatat
tgtactgccgaggtagccatcgcactgttagatatggccggcgataccggggcggcggca
gggttaggcgagcattttacccgctttaaaacacgctatctggcaggaaaaacgcaacat
ctgggtagcatcacagcagaacagttagaaagcgtttaa
              
                            

Download fasta file
RegulonDB