RegulonDB RegulonDB 10.9: Gene Sequence
patZ gene sequence


Size: 2661        A: 610  T: 606  G: 736  C: 709

Fasta

 

>patZ E. coli K12. Version NC_000913.3 GI:556503834
atgagtcagcgaggactggaagcactactgcgaccaaaatcgatagcggtaattggcgcg
tcgatgaaacccaatcgcgcaggttacctgatgatgcgtaacctgctggcgggaggcttt
aacggaccggtactcccggtgacgccagcctggaaagcggtgttgggtgtgttggcctgg
ccggatattgccagcttgccctttacacccgaccttgcggttttatgtaccaatgccagc
cgtaatcttgctcttctggaagagctcggcgagaaaggctgtaaaacctgcattattctt
tccgccccggcatcgcaacacgaagatctccgcgcctgcgccctgcgccataacatgcgc
ctgcttggaccaaacagtctgggtttactggctccctggcaaggtctgaatgccagcttt
tcgcctgtgccgattaaacgcggcaagctggcgtttatttcgcaatcggctgccgtctcc
aacaccatcctcgactgggcgcaacagcgtaagatgggcttttcctactttattgcgctc
ggcgacagcctggatatcgacgttgatgaattgcttgactatctggcacgcgacagtaaa
accagcgccatcctgctctatctcgaacagttaagcgacgcgcgacgctttgtttcggcg
gcccgtagtgcctcgcgtaataaaccgattctggtgattaaaagcggacgtagcccggcg
gcacagcgactgctcaacacgacggcaggaatggacccggcatgggatgcggctattcag
cgtgccggtttgttgcgggtacaggacacccacgagctgttttcggcggtggaaaccctt
agccatatgcgcccgctacgtggcgaccggctgatgattatcagcaacggtgctgcgcct
gccgcgctggcgctggatgccttatggtcacgcaatggcaagctggcaacgctaagcgaa
gaaacctgccagaaactgcgcgatgcactgccagaacatgtggcaatatctaacccgctc
gatctacgcgatgacgccagcagtgagcactatattaaaacgctggatattctgctccac
agccaggattttgacgcgctgatggttattcattcgcccagcgccgctgctcccgcaaca
gaaagcgcgcaagtattaattgaagcggtaaagcatcatccccgcagcaaatatgtctct
ttgctgacgaactggtgcggcgagcactcctcgcaagaggcacgacgtttattcagcgaa
gccgggctgccgacctaccgtaccccggaaggaaccatcactgcttttatgcatatggtg
gagtaccggcgtaatcagaagcaactacgcgaaacgccggcgttgcccagcaatctgact
tccaataccgcagaagcgcatcttctgttgcaacaggcgattgccgaaggggctacgtcg
ctcgatacccatgaagttcagcccatcctgcaagcgtatggcatgaacacgctccctacc
tggattgccagcgatagcaccgaagcggtgcatattgccgaacagattggttatccggtg
gcgctgaaattgcgttcgccggatattccacataaatcggaagttcagggcgtcatgctt
tacctgcgtacagccaatgaagtccagcaagcggcgaacgctattttcgatcgcgtaaaa
atggcctggccacaggcgcgggtccacggcctgttggtgcaaagtatggctaaccgtgct
ggcgctcaggagttgcgggttgtggttgagcacgatccggttttcgggccgttgatcatg
ctgggtgaaggcggtgtggagtggcgtcctgaagatcaagccgtcgtcgcactgccgccg
ctgaacatgaacctggcccgctatctggttattcaggggatcaaaagtaaaaagattcgt
gcgcgcagtgcgctacgcccattggatgttgcaggcttgagccagcttctggtgcaggtt
tccaacttgattgtcgattgcccggaaattcagcgtctggatattcatcctttgctggct
tctggcagtgaatttaccgcgctggatgtcacgctggatatctcgccgtttgaaggcgat
aacgagagtcggctggcagtgcgcccttatccgcatcagctggaagaatgggtagaattg
aaaaacggtgaacgctgcttgttccgcccgattttgccagaagatgagccacaacttcag
caattcatttcgcgagtcaccaaagaagatctttattaccgctactttagcgagatcaac
gaatttacccatgaagatttagccaacatgacacagatcgactacgatcgggaaatggcg
tttgtagcggtacgacgtattgatcaaacggaagagatcctcggcgtcacgcgtgcgatt
tccgatcctgataacatcgatgccgaatttgctgtactggttcgctcggatctcaaaggg
ttaggcttaggtcgacgcttaatggaaaagttgattacctatacgcgagatcacggacta
caacgtctgaatggtattacgatgccaaacaatcgtggcatggtggcgctagcccgcaag
ctcgggtttaacgttgatatccagctcgaagaggggatcgttgggcttacgctaaatctt
gcccagcgcgaggaatcatga
              
                            

Download fasta file
RegulonDB