RegulonDB RegulonDB 10.9: Gene Sequence
bamD gene sequence


Size: 738        A: 197  T: 163  G: 190  C: 188

Fasta

 

>bamD E. coli K12. Version NC_000913.3 GI:556503834
atgacgcgcatgaaatatctggtggcagccgccacactaagcctgtttttggcgggttgc
tcggggtcaaaggaagaagtacctgataatccgccaaatgaaatttacgcgactgcacaa
caaaagctgcaggacggtaactggagacaggcaataacgcaactggaagcgttagataat
cgctatccgtttggtccgtattcgcagcaggtgcagctggatctcatctacgcctactat
aaaaacgccgatttgccgttagcacaggctgccatcgatcgttttattcgccttaacccg
acccatccgaatatcgattatgtcatgtacatgcgtggcctgaccaatatggcgctggat
gacagtgcgctgcaagggttctttggcgtcgatcgtagcgatcgcgatcctcaacatgca
cgagctgcgtttagtgacttttccaaactggtgcgcggctatccgaacagtcagtacacc
accgatgccaccaaacgtctggtattcctgaaagatcgtctggcgaaatatgaatactcc
gtggccgagtactatacagaacgtggcgcatgggttgccgtcgttaaccgcgtagaaggc
atgttgcgcgactacccggatacccaggctacgcgtgatgcgctgccgctgatggaaaat
gcataccgtcagatgcagatgaatgcgcaagctgaaaaagtagcgaaaatcatcgccgca
aacagcagcaatacataa
              
                            

Download fasta file
RegulonDB