RegulonDB RegulonDB 10.9: Gene Sequence
null gene sequence


Size: 207        A: 64  T: 68  G: 36  C: 39

Fasta

 

>null E. coli K12. Version NC_000913.3 GI:556503834
ttgagctgccgtttttttattctgtcagttgtgaaactgaagcgatttagtcgctatcga
tctcatcaaatatggctcgctttgagatattcctcaagtaaaaaaacatctcttcctgcg
atttctcacaaaaaagattcgttgacaaaaagtgacaaaattatgagattttcatcacac
attttgacatcaggaacggtatgctga
              
                            

Download fasta file
RegulonDB