RegulonDB RegulonDB 10.9: Gene Sequence
yfiR gene sequence


Size: 519        A: 132  T: 150  G: 111  C: 126

Fasta

 

>yfiR E. coli K12. Version NC_000913.3 GI:556503834
atgcgtttttctcaccgactgttcttacttctgattctcctgctgacgggagcaccaata
ctcgctcaggagccttctgacgttgcgaaaaacgtgcgtatgatggtttccggtattgtc
agttacacccgctggcctgcgctatcagggccaccaaagttatgtatcttttcatcttca
cgttttagtaccgccctacaagagaatgccgcgacatctttgccttatctgcctgtcatc
attcacactcaacaagaggcgatgatttcaggctgcaatggtttttattttggcaacgag
tcaccgacattccagatggaattaaccgaacaatatccgtcaaaggcgttattattaatt
gccgaacaaaataccgagtgcattattggtagcgccttttgtctgatcatccacaataat
gacgtcagatttgccgtaaacctggatgccttatcgcgtagcggtgtaaaggtcaacccg
gatgtcttaatgctcgcacggaagaaaaatgatggataa
              
                            

Download fasta file
RegulonDB